ALX-746-025-C100 100 ug
Product Specification
SEQUENCE: | TATAATTTTTACCAACTAGC Nucleotides depicted in italics show the corresponding AT-ODN sequence. |
MW: | 6374 |
SOURCE/HOST: | Synthetic. |
QUANTITY: | 15.8nmol |
FORMULATION: | Lyophilized. Sterile. |
ENDOTOXIN CONTENT: | <0.02EU/ug (LAL test; BioWhittaker) |
RECONSTITUTION: | For a 100?M stock solution, dissolve the total vial content in 158?l endotoxin-free water (included) or PBS (to order separay). To obtain optimal dissolving we recommend the following procedure: - Add 50% of the solvent and let dissolve for 10 min. - Add remaining 50% of the solvent and mix thoroughly. - Moderate warming may aid dissolving. |
SHIPPING: | AMBIENT |
LONG TERM STORAGE: | +4°C |
USE/STABILITY: | Aqueous stock solution is stable for 1 day when stored at +4°C. |
HANDLING: | For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C. Protect from light. |
Product Description
Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation. |
Product Specific Literature References
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001) Abstract Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract |